View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5822-3 (Length: 198)
Name: Solexa-NF5822-3
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5822-3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 6e-33; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 34 - 149
Target Start/End: Complemental strand, 36552247 - 36552133
Alignment:
| Q |
34 |
gtttacacaatgtatagactaattctatacattgtgtaaactgcttcttttcagtagtttcttcgatatatcttatgctaaggagaccacttttgctgtg |
133 |
Q |
| |
|
||||| ||| || |||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||| ||| |
|
|
| T |
36552247 |
gtttagacattggatagactaattctatacattgtttgaactgcttcttttcagtagtttcttcggcatatcttgtgctaaggagacca-ttttgcagtg |
36552149 |
T |
|
| Q |
134 |
ttagtatcatcaattt |
149 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
36552148 |
ttagtatcatcaattt |
36552133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 146 - 198
Target Start/End: Complemental strand, 36552112 - 36552060
Alignment:
| Q |
146 |
atttacaaataaatatccatttccttccactagaacatcaatgaaagctcaaa |
198 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36552112 |
atttacaaataaatatccattttcttccactagaacatcaatgaaagctcaaa |
36552060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 36552174 - 36552224
Alignment:
| Q |
1 |
aagatatatcgaagaaactactgaaaagaagcagtttacacaatgtataga |
51 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
36552174 |
aagatatgccgaagaaactactgaaaagaagcagttcaaacaatgtataga |
36552224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University