View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5822-6 (Length: 150)
Name: Solexa-NF5822-6
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5822-6 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 52; Significance: 4e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 4e-21
Query Start/End: Original strand, 99 - 150
Target Start/End: Original strand, 15377418 - 15377469
Alignment:
| Q |
99 |
gggttattatggttttcaaccggttacggcgtatcttgccgtgaactatatg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15377418 |
gggttattatggttttcaaccggttacggcgtatcttgccgtgaactatatg |
15377469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 28; Significance: 0.0000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 8 - 47
Target Start/End: Complemental strand, 4171885 - 4171846
Alignment:
| Q |
8 |
attattagttaagcggtgttggacgttatgtgttgatcgg |
47 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
4171885 |
attattaggtaagcggtgttggctgttatgtgttgatcgg |
4171846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University