View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5822-9 (Length: 138)
Name: Solexa-NF5822-9
Description: NF5822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5822-9 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 7e-47; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 7e-47
Query Start/End: Original strand, 36 - 138
Target Start/End: Complemental strand, 32453608 - 32453506
Alignment:
| Q |
36 |
gagtaaagctttctctcatctttctcttcagttttgcaaagaaaaagaaaagcatgggatccacatgaaattgacatctcttctctatttcttggatctt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32453608 |
gagtaaagctttctctcatctttctcttcagttctgcgaagaaaaagaaaagcatgggatccacatgaaattgacatctcttctctatttcttggatctt |
32453509 |
T |
|
| Q |
136 |
cta |
138 |
Q |
| |
|
||| |
|
|
| T |
32453508 |
cta |
32453506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 56 - 135
Target Start/End: Original strand, 50564014 - 50564093
Alignment:
| Q |
56 |
tttctcttcagttttgcaaagaaaaagaaaagcatgggatccacatgaaattgacatctcttctctatttcttggatctt |
135 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||| |
|
|
| T |
50564014 |
tttctcttcagttctgcgaagaaaaagaaaagcatgggatccacgtgaaattggtatctcttctctatttcttcgatctt |
50564093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University