View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5823-1 (Length: 328)
Name: Solexa-NF5823-1
Description: NF5823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5823-1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 7 - 318
Target Start/End: Original strand, 2233751 - 2234062
Alignment:
| Q |
7 |
aatacccatcaagcagagtggcaacaacagaagtttttgtggtcgaaagcttgtgaccaagttacctactctgtccccaaatgtcttataaaatgggtcc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2233751 |
aatacccatcaagcagagtggcaacaacagaagtttttgtggtcgaaagcttgtgaccaagtcacctactctgtccccaaatgtcttataaaatgggtcc |
2233850 |
T |
|
| Q |
107 |
tatctatccaattaatgtccatgtgaggggctcactcacgtctcttatannnnnnnnnaatctttttctaaggtcccttatcattacaatgccatttctt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2233851 |
tatctatccaattaatgtccatgtgaggggctcactcacgtctcttatattattttttaatctttttctaaggtcccttatcattacaacgccatttctt |
2233950 |
T |
|
| Q |
207 |
tttcttatccttcaatttcgacgtgccatgctttcactcttctatcggcaccaacattttgaaattcctttccccaactaaataggatgatgatgattga |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2233951 |
tttcttatccttcaatttcgacgtgccatgctttcactcttctatcggcaccaacattttgaaattcctttccccaactaaataggacgatgatgattga |
2234050 |
T |
|
| Q |
307 |
tgcacctttcat |
318 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2234051 |
tgcacctttcat |
2234062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University