View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5823-10 (Length: 159)
Name: Solexa-NF5823-10
Description: NF5823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5823-10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 5e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 5e-73
Query Start/End: Original strand, 8 - 158
Target Start/End: Complemental strand, 22293189 - 22293039
Alignment:
| Q |
8 |
taatgaagtagtatttggggacataagttaaggatccgaggcaaaagattcaattcagtctaacagttacttttcagtttgaattgtatagttccctgtt |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22293189 |
taatgaagtagtatttagggacataagttaaggatccgaggcaaaagattcaattcagtctaacagttacttttcagtttgaattgtatagttccctgtt |
22293090 |
T |
 |
| Q |
108 |
aaggaggcagttttacagttattgacatttatttgtttcttctcactcgac |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
22293089 |
aaggaggcagttttacagttattgacatttatttgttacttctaactcgac |
22293039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University