View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5823-13 (Length: 143)
Name: Solexa-NF5823-13
Description: NF5823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5823-13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 17777072 - 17776929
Alignment:
| Q |
1 |
agcaaagggcaattggtcttaattaaaaatgaacaattaccaagaaaaattaattaatgtcacttactattcaagtcaataagagatcactatactagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17777072 |
agcaaagggcaattggtcttaattaaaaatgaacaattcccaagaaaaattaattaatgtcacttactattcaagtcaataagagatcactatattagag |
17776973 |
T |
|
| Q |
101 |
attttattatacgtactttttgttagcaaag-tatcctctcata |
143 |
Q |
| |
|
||| |||||||||||| |||||||||| ||| ||||||| |||| |
|
|
| T |
17776972 |
attatattatacgtacattttgttagcgaagctatcctcacata |
17776929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University