View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5823-16 (Length: 133)
Name: Solexa-NF5823-16
Description: NF5823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5823-16 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 46089619 - 46089751
Alignment:
| Q |
1 |
gaagagtttgagattgttgcaagagccactttggaggacttattgtaatggaaaaaagtgtggatttggtaatagaagagaatgtggtgaaaaagattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46089619 |
gaagagtttgagattgttgcaagagccactttggaggacttattgtaatggaaaaaagtgtggatttggtaatagaagagaatgtggtgaaaaagattgg |
46089718 |
T |
|
| Q |
101 |
gagattttgaaagccgttgagcctatttcaatg |
133 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
46089719 |
gagattttgaaagctgttgagcctatttcaatg |
46089751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 32 - 133
Target Start/End: Complemental strand, 24009718 - 24009617
Alignment:
| Q |
32 |
tggaggacttattgtaatggaaaaaagtgtggatttggtaatagaagagaatgtggtgaaaaagattgggagattttgaaagccgttgagcctatttcaa |
131 |
Q |
| |
|
|||||||| ||||| ||||| || || || ||||||| ||| |||||||||||||| |||| || ||||| ||| | ||||| || ||||| ||||||| |
|
|
| T |
24009718 |
tggaggacatattgcaatggcaagaaatgcggatttgctaacagaagagaatgtggacaaaaggagtgggatattctcaaagctgtggagccaatttcaa |
24009619 |
T |
|
| Q |
132 |
tg |
133 |
Q |
| |
|
|| |
|
|
| T |
24009618 |
tg |
24009617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University