View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5823-21 (Length: 69)
Name: Solexa-NF5823-21
Description: NF5823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5823-21 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 57; Significance: 1e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 57; E-Value: 1e-24
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 568408 - 568340
Alignment:
| Q |
1 |
agcataggaggagggttaaatttgtcatttcgctgaattaaagtgatcgtgagagagggttaggcatat |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
568408 |
agcataggaggagggttaaatttgtcatttcactgaattaaagtgatcgtgagagagggataggaatat |
568340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 1e-24
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 34011167 - 34011235
Alignment:
| Q |
1 |
agcataggaggagggttaaatttgtcatttcgctgaattaaagtgatcgtgagagagggttaggcatat |
69 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
34011167 |
agcagaggaggagggttaaatttgtcatttcgctgaattaaagtgatcgtgagagagggataggaatat |
34011235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 55; Significance: 2e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 2e-23
Query Start/End: Original strand, 3 - 69
Target Start/End: Original strand, 52330071 - 52330137
Alignment:
| Q |
3 |
cataggaggagggttaaatttgtcatttcgctgaattaaagtgatcgtgagagagggttaggcatat |
69 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
52330071 |
cataggaggtgggttaaatttgtcatttcgctgaattaaagtgatcgtgagagagggataggaatat |
52330137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University