View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5823-7 (Length: 187)
Name: Solexa-NF5823-7
Description: NF5823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5823-7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 1e-33; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 8 - 92
Target Start/End: Original strand, 11821489 - 11821573
Alignment:
| Q |
8 |
ctaaaggtagcaaagaatagaaaatggagggcacaaatgttttggtaagtttttctttgaatgtatttgtaattgttatcatctt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
11821489 |
ctaaaggtagcaaagaatagaaaatggagggcacaaatgttttggtgagtttttctttgaatgtgtttataattgttatcatctt |
11821573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 4e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 4e-18
Query Start/End: Original strand, 22 - 92
Target Start/End: Complemental strand, 15273655 - 15273585
Alignment:
| Q |
22 |
gaatagaaaatggagggcacaaatgttttggtaagtttttctttgaatgtatttgtaattgttatcatctt |
92 |
Q |
| |
|
||||||||||| ||||| |||||| ||||||| ||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
15273655 |
gaatagaaaattgagggaacaaatattttggtgagtttttctttgaatgtgtttgtaattgttaccatctt |
15273585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 22 - 93
Target Start/End: Original strand, 44249765 - 44249836
Alignment:
| Q |
22 |
gaatagaaaatggagggcacaaatgttttggtaagtttttctttgaatgtatttgtaattgttatcatcttt |
93 |
Q |
| |
|
||||||||||| |||||||||||||||||||| | |||||||||||||| |||||| |||| |||||||| |
|
|
| T |
44249765 |
gaatagaaaattgagggcacaaatgttttggtgaatttttctttgaatggttttgtagttgtggtcatcttt |
44249836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 12 - 71
Target Start/End: Original strand, 44253365 - 44253424
Alignment:
| Q |
12 |
aggtagcaaagaatagaaaatggagggcacaaatgttttggtaagtttttctttgaatgt |
71 |
Q |
| |
|
|||||||| |||||||| || ||| ||| |||||||||||| ||||||||||||||||| |
|
|
| T |
44253365 |
aggtagcagtgaatagaagattgagtgcaaaaatgttttggtgagtttttctttgaatgt |
44253424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University