View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-10 (Length: 144)
Name: Solexa-NF5824-10
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-10 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 9e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 9e-62
Query Start/End: Original strand, 25 - 144
Target Start/End: Original strand, 34559921 - 34560040
Alignment:
| Q |
25 |
ctcaacctcattcctcaaaacaatgtccttgttgaagaatttatgatgttgaccatattgatctaccacattaatagtttatgtggtgcaaatagtactt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34559921 |
ctcaacctcattcctcaaaacaatgtccttgttgaagaatttatgatgttgaccatattgatctaccacattaatagtttatgtggtgcaaatagtactt |
34560020 |
T |
|
| Q |
125 |
tgcttcttggtcaactcttt |
144 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34560021 |
tgcttcttggtcaactcttt |
34560040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University