View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-12 (Length: 141)
Name: Solexa-NF5824-12
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 1e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 1e-66
Query Start/End: Original strand, 2 - 141
Target Start/End: Original strand, 199160 - 199299
Alignment:
| Q |
2 |
aaagggcatgcgaatgaacaaaaatacccctcatccatttgctctttctggaaaacgaacaaggagaacatgtagacattaatatagctacttgttcact |
101 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
199160 |
aaagagcatgcgaatggacaaaaatacccctcctccatttgctctttctggaaaacgaacaaggagaacatgtagacattaatatagctacttgttcact |
199259 |
T |
 |
| Q |
102 |
tcttcactataattcactataatagatcaaattcatcata |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
199260 |
tcttcactataattcactataatagatcaaattcatcata |
199299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.0000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 11447988 - 11447939
Alignment:
| Q |
19 |
acaaaaatacccctcatccatttgctctttctggaaaacgaacaaggaga |
68 |
Q |
| |
|
||||||||||||||| |||||| |||||||||| |||||||||||||||| |
|
|
| T |
11447988 |
acaaaaatacccctcctccattggctctttctgaaaaacgaacaaggaga |
11447939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University