View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-14 (Length: 139)
Name: Solexa-NF5824-14
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-14 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 7 - 139
Target Start/End: Complemental strand, 10972340 - 10972208
Alignment:
| Q |
7 |
aagcattgctagaagaagccgagaacgagcgcatgcacctaatgactttcatggaagtggcaaaaccaaagtggtatgaacgtgctctggtcataactgt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10972340 |
aagcattgctagaagaagccgagaacgagcgcatgcatctaatgactttcatggaagtggcaaaaccaaagtggtatgaacgtgctctggtcataactgt |
10972241 |
T |
 |
| Q |
107 |
ccaaggtgttttcttcaatgcttatttcttagg |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10972240 |
ccaaggtgttttcttcaatgcttatttcttagg |
10972208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University