View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-15 (Length: 138)
Name: Solexa-NF5824-15
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 27694223 - 27694356
Alignment:
| Q |
1 |
cacagagatcaatattaaaatggcagcgaaaatgggtagtaccccgtacatcatagccattttgattttttggggttggttgggggatctgctcgactca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27694223 |
cacagagatcaatattaaaatggcagcgaaaatgggtagtaccccgtacatcatagccattttgattttttggggttggttgggggatctgctcgactca |
27694322 |
T |
 |
| Q |
101 |
gtcagtcagtcatggctagctacctggactaattatct |
138 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
27694323 |
gtcagtcagtcatg----gctacctggactaattatct |
27694356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University