View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-16 (Length: 138)
Name: Solexa-NF5824-16
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 9e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 9e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 28995813 - 28995874
Alignment:
| Q |
1 |
agggatggttcagttggtgattggttccctagggtaagacaattgaccccatgacaccaagt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28995813 |
agggatggttcagttggtgattggttccctagggtaagacaagtgaccccatgacaccaagt |
28995874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 6 - 48
Target Start/End: Original strand, 28957388 - 28957430
Alignment:
| Q |
6 |
tggttcagttggtgattggttccctagggtaagacaattgacc |
48 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
28957388 |
tggttcagtttgtgattggttccctagggtaagacaagtgacc |
28957430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University