View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-17 (Length: 137)
Name: Solexa-NF5824-17
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 83; Significance: 1e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 1e-39
Query Start/End: Original strand, 11 - 136
Target Start/End: Original strand, 8375460 - 8375588
Alignment:
| Q |
11 |
acaactctctccttgtatgacaatgtttccatcaataggtgccacat---aagttggaattaaagcaatgtctgtcggtacagcattcagctccagccct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || || ||||| |||||||||||||||||||||| ||| |||||||||||| |||| |
|
|
| T |
8375460 |
acaactctctccttgtatgacaatgtttccatcaataggtgtcatatcagaagttcgaattaaagcaatgtctgtcggaacaacattcagctccacccct |
8375559 |
T |
 |
| Q |
108 |
tgcatgacaatggtgtcgttcacgggggg |
136 |
Q |
| |
|
|||||||||||||||| ||||||||||| |
|
|
| T |
8375560 |
tgcatgacaatggtgttattcacgggggg |
8375588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University