View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-19 (Length: 133)
Name: Solexa-NF5824-19
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 9 - 133
Target Start/End: Original strand, 32505777 - 32505901
Alignment:
| Q |
9 |
gaggagaacatcgctgttacatcttaatggaatattgtatctacaagtatttcgacgttcaagtcaattttttattaagatgaatgtaacgaaatgaaat |
108 |
Q |
| |
|
||||||| |||| |||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32505777 |
gaggagagcatcactgttacatcttaatggaatgttgtatctacaagtatttcgactttcaagtcaattttttattaagatgaatgtaacgaaatgaaat |
32505876 |
T |
 |
| Q |
109 |
gtgtacttttctcctagtgcaaaat |
133 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32505877 |
gtgtacttttctcctagtgcaaaat |
32505901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University