View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-26 (Length: 127)
Name: Solexa-NF5824-26
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 3e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 3e-46
Query Start/End: Original strand, 8 - 113
Target Start/End: Complemental strand, 32506802 - 32506697
Alignment:
| Q |
8 |
ggttgtgcttcccacatgaaaggaacagcaacagatgtttcaccataatagaacactctccttgaagatgagttggcatttgaggtttcctttgacatta |
107 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32506802 |
ggttgtgcctcccacatgaaaggaacagcaacagatgtttcaccataatagaaaactctccttgaagatgagttggcatttgaggtttccttggacatta |
32506703 |
T |
 |
| Q |
108 |
gcctag |
113 |
Q |
| |
|
|||||| |
|
|
| T |
32506702 |
gcctag |
32506697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University