View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-3 (Length: 222)
Name: Solexa-NF5824-3
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 47 - 222
Target Start/End: Original strand, 17791143 - 17791327
Alignment:
| Q |
47 |
agagagtgatccttagaaggaatagcatctt---ttgatccaaaatagtaagaattcagaggatatatattcacttccactttc---tcatcatcatcat |
140 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17791143 |
agagagtgatctttagaaggaatagcatcttcttttgatccaaaatagtaagaattcagaggatatatattcacttccactttctcatcatcatcatcat |
17791242 |
T |
 |
| Q |
141 |
cccttattccgttttcacccatcactcctcaaaaatcaaaaactttacagat--tgtata-gtttcaaaatatgtgtcatctctg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||| | | || |||||||||||||||||||||||| |
|
|
| T |
17791243 |
cccttattccgttttcacccatcactcctcaaaaatcaaaaacttcaaagatgctttctatgtttcaaaatatgtgtcatctctg |
17791327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University