View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-35 (Length: 116)
Name: Solexa-NF5824-35
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-35 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 4e-48; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 6934840 - 6934956
Alignment:
| Q |
1 |
aagaatactgtgagcacttaccattggtataaagctttgagcatgtctgatacaaattatgcttttcaatgtgcaagatcaactccctggc-ttccttcc |
99 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6934840 |
aagaatactattagcacttaccattggtataaagctttgagcatgtctgatacaaattatgcctttcaatgtgcaagatcaactccctggctttccttcc |
6934939 |
T |
 |
| Q |
100 |
ttcagttcaaatgagca |
116 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
6934940 |
ttcagttcaaatgagca |
6934956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 57 - 98
Target Start/End: Complemental strand, 6526299 - 6526258
Alignment:
| Q |
57 |
ttatgcttttcaatgtgcaagatcaactccctggcttccttc |
98 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| |||||| |
|
|
| T |
6526299 |
ttatgcctttgaatgtgcaagatcaactccctggcatccttc |
6526258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 57 - 98
Target Start/End: Complemental strand, 6843077 - 6843036
Alignment:
| Q |
57 |
ttatgcttttcaatgtgcaagatcaactccctggcttccttc |
98 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||| |||||| |
|
|
| T |
6843077 |
ttatgcctttgaatgtgcaagatcaactccctggcatccttc |
6843036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University