View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-36 (Length: 115)
Name: Solexa-NF5824-36
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-36 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 10 - 115
Target Start/End: Complemental strand, 27694785 - 27694680
Alignment:
| Q |
10 |
ggtcatcatgaaaactagtttctgcaatttcaactgtaattaaaaagcagaacaagaacacatggatgagagtttttaaccaaatagccatttcgaatgc |
109 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27694785 |
ggtcatcatgaaaactagtttccgcaatttcaactgtaattaaaaagcagaacaagaacacatggatgagagtttttaaccaaatagccatttcgaatgc |
27694686 |
T |
 |
| Q |
110 |
tgatca |
115 |
Q |
| |
|
|||||| |
|
|
| T |
27694685 |
tgatca |
27694680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University