View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-38 (Length: 114)
Name: Solexa-NF5824-38
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-38 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 1e-47; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 7 - 114
Target Start/End: Original strand, 12812485 - 12812592
Alignment:
| Q |
7 |
agttcttttgataacttggtgtatgaagcaatgcaattatccaaagtagctttcagtcgcatgtccttggtttgcgttgaacagttcgaagttgctttaa |
106 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12812485 |
agttcttttgatatcttggtgtatgaagcaatgcaattatccaaagcagctttcagtcgcatgtccttggtttgcgttgaacagtttgaagttgctttaa |
12812584 |
T |
|
| Q |
107 |
tatgaccg |
114 |
Q |
| |
|
|||||||| |
|
|
| T |
12812585 |
tatgaccg |
12812592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 8e-34
Query Start/End: Original strand, 7 - 114
Target Start/End: Original strand, 12838382 - 12838490
Alignment:
| Q |
7 |
agttcttttgataacttggtgtatgaagcaatgcaattatccaaagtagctttcagtcgcatgtccttggtttgcg-ttgaacagttcgaagttgcttta |
105 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||| |||||||||| ||||||| | || |
|
|
| T |
12838382 |
agttcttttgatatcttggtgtatgaagcaatgcaattatccaaagcagctttcagttgtatgtccttggtttgcgcttgaacagtttgaagttgatgta |
12838481 |
T |
|
| Q |
106 |
atatgaccg |
114 |
Q |
| |
|
||||||||| |
|
|
| T |
12838482 |
atatgaccg |
12838490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 7 - 114
Target Start/End: Original strand, 12831555 - 12831663
Alignment:
| Q |
7 |
agttcttttgataacttggtgtatgaagcaatgcaattatccaaagtagctttcagtcgcatgtccttggtttgc-gttgaacagttcgaagttgcttta |
105 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||| |||||||||| ||||||| | || |
|
|
| T |
12831555 |
agttcttttgatatcttggtgtatgaagcaatgcaattatccaaagcagctttcagttgtatgtccttggtttgcacttgaacagtttgaagttgatgta |
12831654 |
T |
|
| Q |
106 |
atatgaccg |
114 |
Q |
| |
|
||||||||| |
|
|
| T |
12831655 |
atatgaccg |
12831663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University