View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-41 (Length: 85)
Name: Solexa-NF5824-41
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 5e-34; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 5e-34
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 36656282 - 36656206
Alignment:
| Q |
8 |
tcaacttcttaaaaatgttttatactatgtttgctcccataataccttcctcgaggaattaggaatctctgtctgtg |
84 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36656282 |
tcaacttcttaaaaatgttttagactatgtttgctcccataataccttcctcgaggaattaggaatctctgtctgtg |
36656206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 8 - 80
Target Start/End: Complemental strand, 36636808 - 36636736
Alignment:
| Q |
8 |
tcaacttcttaaaaatgttttatactatgtttgctcccataataccttcctcgaggaattaggaatctctgtc |
80 |
Q |
| |
|
|||||| |||||||| ||||| ||||||||| ||||||||||||| |||| |||| ||||||||||||||| |
|
|
| T |
36636808 |
tcaactccttaaaaagattttaaactatgtttcctcccataatacccacctccaggatttaggaatctctgtc |
36636736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 77
Target Start/End: Complemental strand, 36643503 - 36643434
Alignment:
| Q |
8 |
tcaacttcttaaaaatgttttatactatgtttgctcccataataccttcctcgaggaattaggaatctct |
77 |
Q |
| |
|
|||||| |||||||| ||||| | ||| ||||||||||||||||| |||| | ||||||||||||||| |
|
|
| T |
36643503 |
tcaactccttaaaaagattttaaattatatttgctcccataatacccacctccacgaattaggaatctct |
36643434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 80
Target Start/End: Original strand, 36909768 - 36909840
Alignment:
| Q |
8 |
tcaacttcttaaaaatgttttatactatgtttgctcccataataccttcctcgaggaattaggaatctctgtc |
80 |
Q |
| |
|
|||||| |||||||| ||||| |||||||| |||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
36909768 |
tcaactccttaaaaagattttaaactatgttacttcccataatacccacctccatgaattaggaatctctgtc |
36909840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University