View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-42 (Length: 75)
Name: Solexa-NF5824-42
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-42 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 53; Significance: 4e-22; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 8 - 72
Target Start/End: Complemental strand, 26616588 - 26616524
Alignment:
| Q |
8 |
ttctcccacaatggatagcattatgctggtacaggaaaacaaaattggggtttctcagactttga |
72 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26616588 |
ttctctcacaatggatagcattatgcaagtacaggaaaacaaaattggggtttctcagactttga |
26616524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 4e-22
Query Start/End: Original strand, 8 - 72
Target Start/End: Complemental strand, 26722516 - 26722452
Alignment:
| Q |
8 |
ttctcccacaatggatagcattatgctggtacaggaaaacaaaattggggtttctcagactttga |
72 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26722516 |
ttctctcacaatggatagcattatgcaagtacaggaaaacaaaattggggtttctcagactttga |
26722452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University