View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-43 (Length: 75)
Name: Solexa-NF5824-43
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-43 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 1e-28; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 8 - 75
Target Start/End: Original strand, 3349277 - 3349344
Alignment:
| Q |
8 |
ctatgtgtatctactgaaacttccctaaaaccttcagttattgagagcaagtttttgagaattgttga |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3349277 |
ctatgtgtatctactgaaacttccctaaaaccttcagttattgagagcaagtttttgagaattattga |
3349344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 6e-18
Query Start/End: Original strand, 10 - 75
Target Start/End: Original strand, 3340405 - 3340470
Alignment:
| Q |
10 |
atgtgtatctactgaaacttccctaaaaccttcagttattgagagcaagtttttgagaattgttga |
75 |
Q |
| |
|
|||||||||||||||||||||| | | |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3340405 |
atgtgtatctactgaaacttccaaacacccttcagttattgagagcaagtttttaagaattgttga |
3340470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 10 - 75
Target Start/End: Complemental strand, 2948601 - 2948536
Alignment:
| Q |
10 |
atgtgtatctactgaaacttccctaaaaccttcagttattgagagcaagtttttgagaattgttga |
75 |
Q |
| |
|
|||||||||||||| || |||| | | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2948601 |
atgtgtatctactgcaatttccaaagacccttcagttattgagagcaagtttttgagaattgttga |
2948536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University