View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5824-8 (Length: 146)
Name: Solexa-NF5824-8
Description: NF5824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5824-8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 1 - 146
Target Start/End: Original strand, 32506479 - 32506624
Alignment:
| Q |
1 |
agaagcataggataataatgtccctagagtctacacatgtagatgttttttgactctaatctagaggcannnnnnnagatctaagtttttacgatatcta |
100 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
32506479 |
agaaccataagataataatgtccctagagtctacacatgtagatgttttttgactctaatctagaggcatttttttagatctaagtttttaagatatcta |
32506578 |
T |
|
| Q |
101 |
gagagtactcaaaaatagtttccaatatctaaaatggttttgaatg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32506579 |
gagagtactcaaaaatagtttccaatatctaaaatggttttgaatg |
32506624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University