View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-1 (Length: 216)
Name: Solexa-NF5825-1
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 30; Significance: 0.00000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 165 - 194
Target Start/End: Complemental strand, 25427717 - 25427688
Alignment:
| Q |
165 |
agatggtgagcaaatgaggattgtgaagga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25427717 |
agatggtgagcaaatgaggattgtgaagga |
25427688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University