View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-13 (Length: 150)
Name: Solexa-NF5825-13
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 47; Significance: 3e-18; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 99 - 149
Target Start/End: Complemental strand, 42221286 - 42221236
Alignment:
| Q |
99 |
ccatgaatttttggattaggatggatatgcagttgtataatagcttggttc |
149 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42221286 |
ccatgaatttttggattagaatggatatgcagttgtataatagcttggttc |
42221236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 38
Target Start/End: Complemental strand, 42221377 - 42221347
Alignment:
| Q |
8 |
tattgataagaaaagaacattgtaagatgag |
38 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42221377 |
tattgataagaaaagaacattgtaagatgag |
42221347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University