View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-15 (Length: 144)
Name: Solexa-NF5825-15
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 9e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 9e-62
Query Start/End: Original strand, 4 - 131
Target Start/End: Original strand, 7024860 - 7024987
Alignment:
| Q |
4 |
caaaggaagttaatagctgctataatatttctcatttagattacaatcacaagttgattagtttcaggccttgtttacatagcttgaaagaatttaacat |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7024860 |
caaaagaagttaatagctgctataatatttctcatttagattacaatcacaagttgattagtttcaggccttatttacatagcttgaaagaatttaacat |
7024959 |
T |
|
| Q |
104 |
tcttgcttgctgtttacaatgcagctag |
131 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7024960 |
tcttgcttgctgtttacaatgcagctag |
7024987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University