View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-16 (Length: 143)
Name: Solexa-NF5825-16
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 48269075 - 48268936
Alignment:
| Q |
1 |
gagaagaaggttgagtcattctcatttgtgctccggggatcgcctgatggaaaggtaaaccagaagcattattatgaaactgttgttgggtgaaaacatg |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| | |
|
|
| T |
48269075 |
gagaagaaggttgagtcattgtcatttgtgctccggggatggcctgatggaaagctaaaccggaagcattattatgaaactgttgttgggtgaaaacagg |
48268976 |
T |
 |
| Q |
101 |
ccccgttttttctaaaacctgatgatttgggaaccccatc |
140 |
Q |
| |
|
|||||| ||| |||||| |||||||||||||||||||||| |
|
|
| T |
48268975 |
ccccgtctttcctaaaagctgatgatttgggaaccccatc |
48268936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University