View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5825-16 (Length: 143)

Name: Solexa-NF5825-16
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5825-16
Solexa-NF5825-16
[»] chr4 (1 HSPs)
chr4 (1-140)||(48268936-48269075)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 48269075 - 48268936
Alignment:
1 gagaagaaggttgagtcattctcatttgtgctccggggatcgcctgatggaaaggtaaaccagaagcattattatgaaactgttgttgggtgaaaacatg 100  Q
    |||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |    
48269075 gagaagaaggttgagtcattgtcatttgtgctccggggatggcctgatggaaagctaaaccggaagcattattatgaaactgttgttgggtgaaaacagg 48268976  T
101 ccccgttttttctaaaacctgatgatttgggaaccccatc 140  Q
    |||||| ||| |||||| ||||||||||||||||||||||    
48268975 ccccgtctttcctaaaagctgatgatttgggaaccccatc 48268936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University