View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-20 (Length: 139)
Name: Solexa-NF5825-20
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-20 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 2e-68; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 2e-68
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 20676111 - 20675973
Alignment:
| Q |
1 |
gatgaatgaggttacaagtttaaagaatgaacttgtgactatgcatgaagtgtttcctgaggaatctgattcttcggccctttcttctccgacaaaatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20676111 |
gatgaatgaggttacaagtttaaagaatgaacttgtgactatgcatgaagtgtttcctgaggaatctgattcttcggccctttcttctccgacaaaatct |
20676012 |
T |
|
| Q |
101 |
tcatcggaagaaagaactcatgaaatatttcatccatct |
139 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
20676011 |
tcatcggaagaaagaactcatgaaacatttcatcgatct |
20675973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University