View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-23 (Length: 132)
Name: Solexa-NF5825-23
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-23 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 7e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 7e-50
Query Start/End: Original strand, 17 - 132
Target Start/End: Complemental strand, 41087627 - 41087512
Alignment:
| Q |
17 |
gtttggtttcacgccagagagcatcaaaatagaattgattatgcctcttggtgaaaatactaatgtttggttgctgtcatacaaaattgattttacctcc |
116 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41087627 |
gtttgatttcacgccagagagcatcaaaatataattgattatgcctcttggtgaaaatacaagtgtttggttgctgtcatacaaaattgattttacctcc |
41087528 |
T |
|
| Q |
117 |
aaatttcaatttgact |
132 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
41087527 |
aaatttcaatttgact |
41087512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University