View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-26 (Length: 127)
Name: Solexa-NF5825-26
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] scaffold0281 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 4e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 4e-36
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 28680767 - 28680647
Alignment:
| Q |
8 |
cttatcattatctttgcatgatttatgcattaagattcaagtatcagggttcaacnnnnnnnn-atatctcaaaatggagaaccacgccaagcaggagtc |
106 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28680767 |
cttatcattatctttgcatgaattatgcattaagattcaagtatcagggttcaattttctttttatatctcaaaatggagaaccacgccaagcatgagtc |
28680668 |
T |
|
| Q |
107 |
acaagggagtttgatattctt |
127 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28680667 |
acaagggagtttgatattctt |
28680647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 69; Significance: 2e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 8 - 127
Target Start/End: Original strand, 31860781 - 31860901
Alignment:
| Q |
8 |
cttatcattatctttgcatgatttatgcattaagattcaagtatcagggttcaacnnnnnnnn-atatctcaaaatggagaaccacgccaagcaggagtc |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||| |
|
|
| T |
31860781 |
cttaccattatctttgcatgatttatgcaataaaattcaagtatcagggttcaactttctttttatatctcaaaatggagaaccacaccaagcagaagtc |
31860880 |
T |
|
| Q |
107 |
acaagggagtttgatattctt |
127 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31860881 |
acaagggagtttgatattctt |
31860901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0281 (Bit Score: 65; Significance: 5e-29; HSPs: 1)
Name: scaffold0281
Description:
Target: scaffold0281; HSP #1
Raw Score: 65; E-Value: 5e-29
Query Start/End: Original strand, 8 - 127
Target Start/End: Original strand, 10264 - 10384
Alignment:
| Q |
8 |
cttatcattatctttgcatgatttatgcattaagattcaagtatcagggttcaacnnnnnnnn-atatctcaaaatggagaaccacgccaagcaggagtc |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
10264 |
cttaccattatctttgcatgatttatgcaataaaattcaagtatcagggttcaactttctttttatatctcaaaatggagaaccaaaccaagcagaagtc |
10363 |
T |
|
| Q |
107 |
acaagggagtttgatattctt |
127 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10364 |
acaagggagtttgatattctt |
10384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University