View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-3 (Length: 200)
Name: Solexa-NF5825-3
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-3 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 6 - 200
Target Start/End: Complemental strand, 4069399 - 4069205
Alignment:
| Q |
6 |
cattagggtatacaagaacaatagcaacattggagtgggatacccatcaaaggcaatgcaagtacaagcaagtttatggaatggtgaaaattgggcaaca |
105 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4069399 |
cattagggtatacaaggacaatagcaacattggagtgggatacccatcaaaggcaatgcaagtacaagcaagtttgtggaatggtgaaaattgggcaaca |
4069300 |
T |
 |
| Q |
106 |
gatggagggaaagccaaaataaattggacaaatgcacctttcaaagcaaacttccaaggatttgatgtcagtggatgtcaaagtcaaaccttaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4069299 |
gatggagggaaagccaaaataaattggacaaatgcacctttcaaagcaaacttccaaggatttgatgtcagtggatgtcaaagtcaaaccttaat |
4069205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University