View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-33 (Length: 112)
Name: Solexa-NF5825-33
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-33 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 5e-44; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 5e-44
Query Start/End: Original strand, 11 - 112
Target Start/End: Original strand, 30371078 - 30371179
Alignment:
| Q |
11 |
gacccatcacgaactaaaccaggcccatcatcccctagattggaccgcttcaccgaaggaagatccgaaacagaacgtttcgatagcatcaataagtcga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
30371078 |
gacccatcacgaactaaaccaggcccatcatcacctagattggaccgcttcaccgaaggaagatccgaaacagaacgtttcgataacatcaaaaagtcga |
30371177 |
T |
 |
| Q |
111 |
gc |
112 |
Q |
| |
|
|| |
|
|
| T |
30371178 |
gc |
30371179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University