View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-35 (Length: 107)
Name: Solexa-NF5825-35
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-35 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 9e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 9e-52
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 39814034 - 39814140
Alignment:
| Q |
1 |
gatgaggtatgtcttagtacttacctactggttaaatatacaatctttaattaagaagattgttattttttggatatctcatattacttcattccattct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39814034 |
gatgaggtatgtcttagtacttacctactggttaaatatacaatctttaattaagaaaattgttattttttggatatctcatattacttcattccattct |
39814133 |
T |
 |
| Q |
101 |
tttagca |
107 |
Q |
| |
|
||||||| |
|
|
| T |
39814134 |
tttagca |
39814140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University