View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-36 (Length: 102)
Name: Solexa-NF5825-36
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 63; Significance: 6e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 6e-28
Query Start/End: Original strand, 25 - 87
Target Start/End: Complemental strand, 6360953 - 6360891
Alignment:
| Q |
25 |
aaacctgaaatattgttcctgttatatggtctcagccgcataggtttttgcagcaattttgat |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6360953 |
aaacctgaaatattgttcctgttatatggtctcagccgcataggtttttgcagcaattttgat |
6360891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University