View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-37 (Length: 95)
Name: Solexa-NF5825-37
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-37 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 1e-44; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 48268800 - 48268706
Alignment:
| Q |
1 |
ggtgagggaggtgggatttccattctagattggtgcaactcatatggctgctgcgataaagcaacaggcacagacttttctaattcagcctcatt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48268800 |
ggtgagggaggtgggatttccattctagattggtgcaactcatatggctgctgcgataaagcaacaggcacagacttttctaattcaacctcatt |
48268706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 48268848 - 48268818
Alignment:
| Q |
1 |
ggtgagggaggtgggatttccattctagatt |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48268848 |
ggtgagggaggtgggatttccattctagatt |
48268818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 48268896 - 48268866
Alignment:
| Q |
1 |
ggtgagggaggtgggatttccattctagatt |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48268896 |
ggtgagggaggtgggatttccattctagatt |
48268866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University