View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5825-9 (Length: 151)
Name: Solexa-NF5825-9
Description: NF5825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5825-9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 8e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 8e-47
Query Start/End: Original strand, 34 - 151
Target Start/End: Original strand, 32311664 - 32311784
Alignment:
| Q |
34 |
ctctattacgtggaagtttgatattagcttcatttaattt---tattatctgatttagttttttagtgtgcttgctttatggctaaaacaccaagttttt |
130 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32311664 |
ctctattacgtggaagtttaatattagctttatttaatttcagtagtatctgatttagttttttagtgtgcttgctttatggctaaaacaccaagttttt |
32311763 |
T |
 |
| Q |
131 |
tcttgattttttaatgtaact |
151 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32311764 |
tcttgattttttaatgtaact |
32311784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University