View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5827-11 (Length: 128)
Name: Solexa-NF5827-11
Description: NF5827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5827-11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 23939435 - 23939316
Alignment:
| Q |
8 |
catagcaatagacaaattctttaggaaaaatgaggtactttcttggaaaagttaagaagaatgatcaaggtattttcattattcaaagcaaatatactgg |
107 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| | ||||||||||||| ||| |
|
|
| T |
23939435 |
catagcaataaacaaattatttaggaaaaatgaggtactttcttggagaagttaagcagaatgatcaaggtattttcatcaatcaaagcaaatatgttgg |
23939336 |
T |
 |
| Q |
108 |
tgaaatactaacaagatttg |
127 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
23939335 |
ttaaatactaacaagatttg |
23939316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University