View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5827-12 (Length: 128)
Name: Solexa-NF5827-12
Description: NF5827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5827-12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 7 - 128
Target Start/End: Complemental strand, 7118012 - 7117891
Alignment:
| Q |
7 |
acatatggcccctgaaacaatcgacnnnnnnngaataaaactggatacacatactaatatagtatacctatatggtttaacatggctttttgatgtatga |
106 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7118012 |
acatatggcacctgaaacaatcgactttttttgaataaaactggatacacatactgatatagtatacctatatggtttaacatggctttttgatgtatga |
7117913 |
T |
|
| Q |
107 |
cagtgacagcgatcataacaac |
128 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
7117912 |
cagtgacagcaatcataacaac |
7117891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University