View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5827-13 (Length: 128)

Name: Solexa-NF5827-13
Description: NF5827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5827-13
Solexa-NF5827-13
[»] chr1 (1 HSPs)
chr1 (7-128)||(38130052-38130173)


Alignment Details
Target: chr1 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 7 - 128
Target Start/End: Original strand, 38130052 - 38130173
Alignment:
7 actggatggaacacattagtgtagtcccacgaggttctgttaacaggagaaatttgaagctcttcctcaaatctatttctcatggactcaagagattgcc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
38130052 actggatggaacacattagtgtagtcccacgaggttctgttaacaggagaaatctgaagctcttcctcaaatctatttctcatggactcaagagattgcc 38130151  T
107 taaccaggatgtacccaagatg 128  Q
    ||||||||||||||||||||||    
38130152 taaccaggatgtacccaagatg 38130173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University