View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5827-13 (Length: 128)
Name: Solexa-NF5827-13
Description: NF5827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5827-13 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 7 - 128
Target Start/End: Original strand, 38130052 - 38130173
Alignment:
| Q |
7 |
actggatggaacacattagtgtagtcccacgaggttctgttaacaggagaaatttgaagctcttcctcaaatctatttctcatggactcaagagattgcc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38130052 |
actggatggaacacattagtgtagtcccacgaggttctgttaacaggagaaatctgaagctcttcctcaaatctatttctcatggactcaagagattgcc |
38130151 |
T |
|
| Q |
107 |
taaccaggatgtacccaagatg |
128 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38130152 |
taaccaggatgtacccaagatg |
38130173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University