View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5827-14 (Length: 125)
Name: Solexa-NF5827-14
Description: NF5827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5827-14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 8 - 125
Target Start/End: Original strand, 44818274 - 44818391
Alignment:
| Q |
8 |
gttaccaatttgataagcagtttgatctggaaaacattgtttactcaaacccaagttgagcttatcttttccacttgtttgacagtttgatgctttggtg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44818274 |
gttaccaatttgataagcagtttgatctggaaaacattgtttactcaaacccaagttgagcttatcttttccacttgtttgacagtttgatgctttggtg |
44818373 |
T |
|
| Q |
108 |
aaaagtaagaagattaca |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
44818374 |
aaaagtaagaagattaca |
44818391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University