View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5827-16 (Length: 124)
Name: Solexa-NF5827-16
Description: NF5827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5827-16 |
 |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 50; Significance: 5e-20; HSPs: 18)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 49 - 102
Target Start/End: Original strand, 17095630 - 17095683
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaaaat |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17095630 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaaaaat |
17095683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 11404081 - 11404130
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11404081 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
11404130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 50 - 99
Target Start/End: Complemental strand, 11909474 - 11909425
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11909474 |
cgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaaa |
11909425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 29767266 - 29767315
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29767266 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
29767315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 32296691 - 32296642
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
32296691 |
ccgaaggtcttccctgccttggattggggcaccatcccctcaccctaaaa |
32296642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 48 - 97
Target Start/End: Original strand, 43288151 - 43288200
Alignment:
| Q |
48 |
tccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaa |
97 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
43288151 |
tccgaaggtcttccctgccttggactggagcaccatcccctcaccctaaa |
43288200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 52 - 98
Target Start/End: Original strand, 4840223 - 4840269
Alignment:
| Q |
52 |
aaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
4840223 |
aaggtcttccctgccttggactagggcaccatcccctcaccctaaaa |
4840269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 56 - 98
Target Start/End: Original strand, 19723398 - 19723440
Alignment:
| Q |
56 |
tcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19723398 |
tcttccctgccttggactggggcaccatcccctcaccctaaaa |
19723440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 22711589 - 22711638
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
22711589 |
ccgaaggtcttccttgccttggactggggcaccatcccctcatcctaaaa |
22711638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 50 - 98
Target Start/End: Original strand, 41553366 - 41553414
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
41553366 |
cgaaggtcttccctgccttagactggagcaccatcccctcaccctaaaa |
41553414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 51 - 98
Target Start/End: Complemental strand, 27879610 - 27879563
Alignment:
| Q |
51 |
gaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
27879610 |
gaagatcttccctaccttggactggggcaccatcccctcaccctaaaa |
27879563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 51 - 98
Target Start/End: Complemental strand, 28019791 - 28019744
Alignment:
| Q |
51 |
gaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
28019791 |
gaagatcttccctaccttggactggggcaccatcccctcaccctaaaa |
28019744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 49 - 99
Target Start/End: Complemental strand, 28739613 - 28739563
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaa |
99 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||| |||||||||||| |
|
|
| T |
28739613 |
ccgaaggtcttccctaccttggactgcagcaccatcccctcaccctaaaaa |
28739563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 36261726 - 36261775
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
36261726 |
ccgaagatcttccctgccttgaactggggcaccatcccctcaccttaaaa |
36261775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 49 - 81
Target Start/End: Complemental strand, 21355036 - 21355004
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcacc |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21355036 |
ccgaaggtcttccctgccttggactggggcacc |
21355004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 11610360 - 11610409
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||| | | ||||||||||||||||||||| ||||||||||| |
|
|
| T |
11610360 |
ccgaaggtcttacttatcttggactggggcaccatcccctcaccctaaaa |
11610409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 30682919 - 30682967
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
30682919 |
ccgaagatcttccctgccttggact-gggcaccatcccctcaccttaaaa |
30682967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 54 - 97
Target Start/End: Complemental strand, 44741967 - 44741924
Alignment:
| Q |
54 |
ggtcttccctgccttggactggggcaccatcccatcaccctaaa |
97 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
44741967 |
ggtcttacctgccttggactggggtgccatcccctcaccctaaa |
44741924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 5e-20; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 49 - 110
Target Start/End: Original strand, 15070205 - 15070266
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaaaatttgtaacc |
110 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
15070205 |
ccgaaggtcttccctgccttagactggggcaccatcccctcacccaaaaaaaatttgtaacc |
15070266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 20685405 - 20685454
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20685405 |
ccgaaggtcttccctgccttggactggggcaccatcccttcaccctaaaa |
20685454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 35163802 - 35163753
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35163802 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
35163753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 17948760 - 17948809
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||| ||||| ||||| |
|
|
| T |
17948760 |
ccgaaggtcttccctgtcttggactgggacaccatcccctcaccttaaaa |
17948809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 50 - 92
Target Start/End: Complemental strand, 14505575 - 14505533
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcacc |
92 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
14505575 |
cgaagatcttccgtgccttggactggggcaccatcccctcacc |
14505533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 2e-19; HSPs: 16)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 49 - 109
Target Start/End: Original strand, 51066573 - 51066632
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaaaatttgtaac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
51066573 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccct-aaaaaatttgtaac |
51066632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 48 - 98
Target Start/End: Original strand, 2570280 - 2570330
Alignment:
| Q |
48 |
tccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2570280 |
tccgaagatcttccctgccttggactggggcaccatcccctcaccctaaaa |
2570330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 49 - 99
Target Start/End: Complemental strand, 46494450 - 46494400
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaa |
99 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
46494450 |
ccgaaggtcttccctaccttggactggggcaccatcccctcaccctaaaaa |
46494400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 7173637 - 7173588
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
7173637 |
ccgaaggtcttccctgcgttggactggggcaccatcccctcaccctaaaa |
7173588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 36192621 - 36192670
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
36192621 |
ccgaaggtcttccctaccttggactggggcaccatcccctcaccctaaaa |
36192670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 49 - 104
Target Start/End: Complemental strand, 2294768 - 2294713
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaaaattt |
104 |
Q |
| |
|
||||| |||||| ||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2294768 |
ccgaaagtcttcactgccttagactggggcaccatcccctcaccctaaaaaaattt |
2294713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 55 - 98
Target Start/End: Original strand, 55231773 - 55231816
Alignment:
| Q |
55 |
gtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55231773 |
gtcttccctgccttggactggggcaccatcccctcaccctaaaa |
55231816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 51 - 97
Target Start/End: Original strand, 32139246 - 32139292
Alignment:
| Q |
51 |
gaaggtcttccctgccttggactggggcaccatcccatcaccctaaa |
97 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32139246 |
gaaggtcttctctgccttggactggggcaccatcccttcaccctaaa |
32139292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 22304143 - 22304094
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
22304143 |
ccgaaggtcttccctaccttggactggggcaccatcctctcaccctaaaa |
22304094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 29576495 - 29576544
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
29576495 |
ccgaaggtcttccctgccttggattggggcaccaccccctcaccctaaaa |
29576544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 51714017 - 51713968
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| ||||||||||| |
|
|
| T |
51714017 |
ccgaaggtcttccctgctttgaactggggcaccatcccctcaccctaaaa |
51713968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 50 - 98
Target Start/End: Complemental strand, 30970435 - 30970387
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
30970435 |
cgaaggtcttccctaccttagactggggcaccatcccctcaccctaaaa |
30970387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 55 - 99
Target Start/End: Original strand, 51066240 - 51066284
Alignment:
| Q |
55 |
gtcttccctgccttggactggggcaccatcccatcaccctaaaaa |
99 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
51066240 |
gtcttccctgccttgaactggggcaccatcccctcaccctaaaaa |
51066284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 48 - 98
Target Start/End: Original strand, 50905827 - 50905877
Alignment:
| Q |
48 |
tccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
50905827 |
tccgaaggtcttccatgccttgaactggggcaccatcctttcaccctaaaa |
50905877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 50 - 98
Target Start/End: Complemental strand, 47627044 - 47626996
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| | ||||||||||| |
|
|
| T |
47627044 |
cgaaggtcttccctgccttggactggaacaccatctcctcaccctaaaa |
47626996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 48 - 99
Target Start/End: Complemental strand, 23084518 - 23084467
Alignment:
| Q |
48 |
tccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaa |
99 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| |||||| | |||||||||||| |
|
|
| T |
23084518 |
tccgaaggtcttccctaccttgaactggggtaccatctcctcaccctaaaaa |
23084467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 2e-19; HSPs: 16)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 30054494 - 30054442
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaaaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30054494 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaaaaa |
30054442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 49 - 101
Target Start/End: Original strand, 21090195 - 21090247
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaaaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
21090195 |
ccgaaggtcttccctgccttggactggggcaccatcccctcactctaaaaaaa |
21090247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 12025261 - 12025310
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
12025261 |
ccgaaggtcttccctgccttggactggggcaccaccccctcaccctaaaa |
12025310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 22024183 - 22024232
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22024183 |
ccgaaggtcttctctgccttggactggggcaccatcccctcaccctaaaa |
22024232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 30370112 - 30370063
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
30370112 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccttaaaa |
30370063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 45324086 - 45324135
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
45324086 |
ccgaaggtcttccctgctttggactggggcaccatcccctcaccctaaaa |
45324135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 51 - 98
Target Start/End: Original strand, 20014540 - 20014587
Alignment:
| Q |
51 |
gaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
20014540 |
gaaggtcttccctgccttggactgaggcaccatcccctcaccctaaaa |
20014587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 52 - 98
Target Start/End: Complemental strand, 14498128 - 14498082
Alignment:
| Q |
52 |
aaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
14498128 |
aaggtcttccctgccttggactggggcgccatcccctcaccctaaaa |
14498082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 17015200 - 17015249
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||| ||||||| |
|
|
| T |
17015200 |
ccgaaggtcttccctgctttggactggggcaccatcccctcatcctaaaa |
17015249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 30850892 - 30850843
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
30850892 |
ccgaaggtctttcctgtcttggactggggcaccatcccctcaccctaaaa |
30850843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 35371797 - 35371754
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcacc |
92 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35371797 |
ccgaagttcttccctgccttggactggggcaccatcccctcacc |
35371754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 49 - 99
Target Start/End: Original strand, 35618055 - 35618105
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaa |
99 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
35618055 |
ccgaaggtcttccttgctttggactggggtaccatcccctcaccctaaaaa |
35618105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 33762592 - 33762543
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||| || |||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
33762592 |
ccgaaagttttccctgccttggactggggcatcatcccctcaccctaaaa |
33762543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 50 - 101
Target Start/End: Complemental strand, 44438601 - 44438550
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaaaa |
101 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| || || |||||||| |
|
|
| T |
44438601 |
cgaaggtcttccctgccttgaactggggtaccatcccctcgccttaaaaaaa |
44438550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 33763306 - 33763257
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||| || |||||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
33763306 |
ccgaaagttttccctgccttgaactggggcatcatcccctcaccctaaaa |
33763257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 50 - 98
Target Start/End: Original strand, 4573460 - 4573508
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||| ||||||||||| |
|
|
| T |
4573460 |
cgaaggtcttccctgttttggactgaggcactatcccctcaccctaaaa |
4573508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 3e-18; HSPs: 15)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 48 - 98
Target Start/End: Complemental strand, 21577151 - 21577101
Alignment:
| Q |
48 |
tccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21577151 |
tccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
21577101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 49 - 99
Target Start/End: Complemental strand, 38405206 - 38405156
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38405206 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaaa |
38405156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 245316 - 245267
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
245316 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
245267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 35109771 - 35109820
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35109771 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
35109820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 37095262 - 37095213
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37095262 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
37095213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 38265289 - 38265240
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38265289 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
38265240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 49 - 97
Target Start/End: Original strand, 41151253 - 41151301
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaa |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41151253 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaa |
41151301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 49 - 100
Target Start/End: Complemental strand, 16059405 - 16059354
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaaa |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16059405 |
ccgaaggtcttccctaccttggactggggcaccatcccctcaccctaaaaaa |
16059354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 50 - 100
Target Start/End: Complemental strand, 18116995 - 18116945
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaaa |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18116995 |
cgaagatcttccctgccttggactggggcaccatcccctcaccctaaaaaa |
18116945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 34721914 - 34721963
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
34721914 |
ccgaaggacttccctgccttggactcgggcaccatcccctcaccctaaaa |
34721963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 45278532 - 45278581
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
45278532 |
ccgaatgtcttccctgccttggactggagcaccatcccctcaccctaaaa |
45278581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 50 - 97
Target Start/End: Original strand, 12472202 - 12472249
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcaccctaaa |
97 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||| |||||||||| |
|
|
| T |
12472202 |
cgaaggtcttccctgtcttggactggggtaccatcccctcaccctaaa |
12472249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 65 - 101
Target Start/End: Original strand, 48176496 - 48176532
Alignment:
| Q |
65 |
ccttggactggggcaccatcccatcaccctaaaaaaa |
101 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48176496 |
ccttggactggggcaccatcccctcaccctaaaaaaa |
48176532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 50 - 97
Target Start/End: Original strand, 24123070 - 24123117
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcaccctaaa |
97 |
Q |
| |
|
||||||||||| |||||||||| |||| |||||||| |||||||||| |
|
|
| T |
24123070 |
cgaaggtcttctctgccttggattgggtcaccatcctctcaccctaaa |
24123117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 59 - 98
Target Start/End: Original strand, 39234853 - 39234892
Alignment:
| Q |
59 |
tccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||| |||| |
|
|
| T |
39234853 |
tccctgccatggactggggcaccatcccctcacccaaaaa |
39234892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 3e-18; HSPs: 18)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 48 - 98
Target Start/End: Complemental strand, 37330660 - 37330610
Alignment:
| Q |
48 |
tccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37330660 |
tccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
37330610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 8400935 - 8400984
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8400935 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
8400984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 50823778 - 50823827
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50823778 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
50823827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 50852082 - 50852033
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
50852082 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
50852033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 52545401 - 52545450
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52545401 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
52545450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 49 - 100
Target Start/End: Original strand, 55468080 - 55468131
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55468080 |
ccgaaggtcttctctgccttggactggggcaccatcccctcaccctaaaaaa |
55468131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 49 - 99
Target Start/End: Original strand, 34824636 - 34824686
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaa |
99 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34824636 |
ccgaaggtcttcccggccttggactggggcaccatcccctcaccctaaaaa |
34824686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 49 - 99
Target Start/End: Complemental strand, 43334106 - 43334056
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
43334106 |
ccgaaggtcttccctgccttggactggggtaccatcccctcaccctaaaaa |
43334056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 7417878 - 7417927
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7417878 |
ccgaaggtcttcactgccttggactggggcaccatcccctcaccctaaaa |
7417927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 35198845 - 35198894
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
35198845 |
ccgaaggtcttccctgccttggactggagcaccatcccctcaccctaaaa |
35198894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 48 - 98
Target Start/End: Complemental strand, 19872536 - 19872486
Alignment:
| Q |
48 |
tccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||| ||||||| |
|
|
| T |
19872536 |
tccgaaggtcttccctgtcttggactggggcaccatcccctcatcctaaaa |
19872486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 52 - 98
Target Start/End: Original strand, 22855970 - 22856016
Alignment:
| Q |
52 |
aaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
22855970 |
aaggtcttccctgccttggactggagcaccatcccctcaccctaaaa |
22856016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 48 - 98
Target Start/End: Complemental strand, 25910719 - 25910669
Alignment:
| Q |
48 |
tccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
25910719 |
tccgaagatcttccctgccttggactgaggcaccatcccctcaccctaaaa |
25910669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 30534954 - 30534905
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
30534954 |
ccgaagatcttccctgccttggactggggtaccatcccctcaccctaaaa |
30534905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 22371781 - 22371732
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||| |||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
22371781 |
ccgaagatcttccctgctttagactggggcaccatcccctcaccctaaaa |
22371732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 37454796 - 37454747
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||| ||||||||||| |
|
|
| T |
37454796 |
ccgaaggtcttccctaccttagattggggcaccatcccctcaccctaaaa |
37454747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 58 - 95
Target Start/End: Original strand, 773666 - 773703
Alignment:
| Q |
58 |
ttccctgccttggactggggcaccatcccatcacccta |
95 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
773666 |
ttcccttccttggactggggcaccatcccctcacccta |
773703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 51 - 96
Target Start/End: Complemental strand, 31297574 - 31297529
Alignment:
| Q |
51 |
gaaggtcttccctgccttggactggggcaccatcccatcaccctaa |
96 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||| || ||||||||| |
|
|
| T |
31297574 |
gaaggtcttccttgccttggactggggaaccatgccctcaccctaa |
31297529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 1e-17; HSPs: 7)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 17064403 - 17064452
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17064403 |
ccgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
17064452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 49 - 99
Target Start/End: Complemental strand, 20983055 - 20983005
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaa |
99 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20983055 |
ccgaaagtcttccctgccttggactggggcaccatcccctcaccctaaaaa |
20983005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 37976630 - 37976679
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||| || ||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
37976630 |
ccgaaggtttttcctgccttgaactggggcaccatcccctcaccctaaaa |
37976679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 52 - 96
Target Start/End: Original strand, 31673912 - 31673956
Alignment:
| Q |
52 |
aaggtcttccctgccttggactggggcaccatcccatcaccctaa |
96 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
31673912 |
aaggtcctccctgccttggactggggcaccaacccctcaccctaa |
31673956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 54 - 97
Target Start/End: Complemental strand, 39162902 - 39162859
Alignment:
| Q |
54 |
ggtcttccctgccttggactggggcaccatcccatcaccctaaa |
97 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39162902 |
ggtcttctgtgccttggactggggcaccgtcccatcaccctaaa |
39162859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 41910904 - 41910953
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||| |||||| |||||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
41910904 |
ccgaatgtcttctctgccttgaactggggcaccatcccctcaccttaaaa |
41910953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 58 - 98
Target Start/End: Complemental strand, 35237102 - 35237062
Alignment:
| Q |
58 |
ttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||| |||||| |
|
|
| T |
35237102 |
ttccctgccttggactgaggcaccatcccctcactctaaaa |
35237062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 1e-17; HSPs: 21)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 45137022 - 45136973
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45137022 |
ccgaaggtcttccctgccttggactggggcaccatcccttcaccctaaaa |
45136973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 50 - 98
Target Start/End: Complemental strand, 2754102 - 2754054
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2754102 |
cgaaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
2754054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 52 - 98
Target Start/End: Complemental strand, 2098875 - 2098829
Alignment:
| Q |
52 |
aaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2098875 |
aaggtcttccctgccttggactggggcaccatcccctcaccctaaaa |
2098829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 10745284 - 10745235
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10745284 |
ccgaaggtattccctgccttggactggggcaccatcccctcaccctaaaa |
10745235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 17136467 - 17136516
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17136467 |
ccgaaggtcttccccgccttggactggggcaccatcccctcaccctaaaa |
17136516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 50 - 98
Target Start/End: Complemental strand, 2357127 - 2357079
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2357127 |
cgaaggtcttccatgccttggactggggcaccatcccctcaccctaaaa |
2357079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 50 - 98
Target Start/End: Original strand, 26690235 - 26690283
Alignment:
| Q |
50 |
cgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
26690235 |
cgaaggtcttccctgccttggactgaggcaccatcccctcaccctaaaa |
26690283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 6672845 - 6672802
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcacc |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6672845 |
ccgaaggtcttccctgccttggactggggcaccatcccctcacc |
6672802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 48 - 98
Target Start/End: Original strand, 44650472 - 44650522
Alignment:
| Q |
48 |
tccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
44650472 |
tccgaagatcttccctgccttggaccggggcaccatcccctcaccctaaaa |
44650522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 36380184 - 36380135
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||| ||||||||||| |
|
|
| T |
36380184 |
ccgaaggtcttccctaccttggactgaggcaccatcccctcaccctaaaa |
36380135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 36836381 - 36836332
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
36836381 |
ccgaagatcttccctgccttggactggggcaccatcccctcaccttaaaa |
36836332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 51 - 98
Target Start/End: Complemental strand, 558489 - 558442
Alignment:
| Q |
51 |
gaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| ||||||||||| |
|
|
| T |
558489 |
gaaggtcttcccttccttggaatggggcaccatcccctcaccctaaaa |
558442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 48 - 98
Target Start/End: Complemental strand, 25987715 - 25987664
Alignment:
| Q |
48 |
tccgaaggtctt-ccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
25987715 |
tccgaaggtctttccctgccttggtctggggcaccatcccctcaccctaaaa |
25987664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 56 - 98
Target Start/End: Complemental strand, 13047201 - 13047159
Alignment:
| Q |
56 |
tcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
13047201 |
tcttccctgccttggactggagcaccatcccctcaccctaaaa |
13047159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 52 - 98
Target Start/End: Original strand, 21637980 - 21638026
Alignment:
| Q |
52 |
aaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
21637980 |
aaggtcttctctgccttggactagggcaccatcccctcaccctaaaa |
21638026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 40156120 - 40156169
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
40156120 |
ccgaaggtcttccctaccttgaactggggcaccatcccctcaccataaaa |
40156169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 51 - 98
Target Start/End: Original strand, 33066672 - 33066719
Alignment:
| Q |
51 |
gaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||| ||| ||||||| |
|
|
| T |
33066672 |
gaaggtcttctctaccttggactggggcaccatcccctcatcctaaaa |
33066719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 5039500 - 5039549
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
|||||| |||||||| ||||||||| |||||||||||| |||| |||||| |
|
|
| T |
5039500 |
ccgaagatcttccctaccttggactagggcaccatcccctcactctaaaa |
5039549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 49 - 86
Target Start/End: Original strand, 21487228 - 21487265
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatccc |
86 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
21487228 |
ccgaaagtcttccctgccttagactggggcaccatccc |
21487265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 30372732 - 30372683
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaa |
98 |
Q |
| |
|
||||||||||||| ||||||| ||||||| ||||| || ||||||||||| |
|
|
| T |
30372732 |
ccgaaggtcttccatgccttgaactggggtaccataccctcaccctaaaa |
30372683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 48 - 99
Target Start/End: Complemental strand, 4553611 - 4553560
Alignment:
| Q |
48 |
tccgaaggtcttccctgccttggactggggcaccatcccatcaccctaaaaa |
99 |
Q |
| |
|
|||| |||||||| ||| ||| ||||||||||||||||| |||| ||||||| |
|
|
| T |
4553611 |
tccggaggtcttctctgtcttagactggggcaccatcccctcactctaaaaa |
4553560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 107743 - 107700
Alignment:
| Q |
49 |
ccgaaggtcttccctgccttggactggggcaccatcccatcacc |
92 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
107743 |
ccgaaggtctaccctgccttggactggggcaccatcccctcacc |
107700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University