View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5827-18 (Length: 114)
Name: Solexa-NF5827-18
Description: NF5827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5827-18 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 44819287 - 44819174
Alignment:
| Q |
1 |
cagagatagttggacttggaagcacttacggctattgcaacttatcgcgtttccggcggagggttaatgttacttcaccaaacacgaccttaatatcatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44819287 |
cagagatagttggacttggaagcacttacggctattgcaacttatcgcgtttccggcggagggttaatgttacttcaccaaacacgaccttaatatcatc |
44819188 |
T |
|
| Q |
101 |
aattatcttcccta |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44819187 |
aattatcttcccta |
44819174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University