View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5827-19 (Length: 113)
Name: Solexa-NF5827-19
Description: NF5827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5827-19 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 6e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 6e-56
Query Start/End: Original strand, 4 - 113
Target Start/End: Complemental strand, 33675635 - 33675526
Alignment:
| Q |
4 |
agatcaaataaaagagttgacttcagagggagcttttgatttccaaagtgattaatcaagaagaaaaatagcccaactcaacccaaagaatgcgtaagga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33675635 |
agatcaaataaaagagttgacttcagagggagcttttgatttccaaagtgattaatcaagaagaaaaatagcccaactcaacccaaagaatgcgtaagga |
33675536 |
T |
 |
| Q |
104 |
attatataca |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
33675535 |
attatataca |
33675526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University