View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5827-20 (Length: 111)
Name: Solexa-NF5827-20
Description: NF5827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5827-20 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 38; Significance: 0.0000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.0000000000006
Query Start/End: Original strand, 70 - 111
Target Start/End: Complemental strand, 29008210 - 29008169
Alignment:
| Q |
70 |
tttcgagaaactcatcttgatacaaacatacagtaggttaga |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29008210 |
tttcgacaaactcatcttgatacaaacatacagtaggttaga |
29008169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University