View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5827-8 (Length: 143)
Name: Solexa-NF5827-8
Description: NF5827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5827-8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 4 - 143
Target Start/End: Original strand, 49738898 - 49739039
Alignment:
| Q |
4 |
atgaaccatggagaattattaaatgaaaacaagag--tttgaaaaccaaattgttcccctaaaaaataaaatcaattccggttgaagaggagctagttgt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49738898 |
atgaaccatggagaattattaaatgaaaacaagagagtttgaaaaccaaattgttcccctaaaaaataaaatcaattccggttgaaggggagctagttgt |
49738997 |
T |
|
| Q |
102 |
ttgttaccttggaaactagatgaactacttggttggtgttaa |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49738998 |
ttgttaccttggaaactagatgaactacttggttggtgttaa |
49739039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University