View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5827-9 (Length: 140)
Name: Solexa-NF5827-9
Description: NF5827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5827-9 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 8 - 140
Target Start/End: Original strand, 33673859 - 33673986
Alignment:
| Q |
8 |
ctaataacttttgcctcttttctttgagtaattattgttgtttctttagattttctcaatgcaaataaaggtttaatgcatcatgtgaagtaatatcaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33673859 |
ctaataacttttgcctcttttctttgagtaattattgttgtttctttagattttctcaatgcaaataaaggtttaatgcatcat-----ctaatatcaat |
33673953 |
T |
|
| Q |
108 |
agatcttacagatgatataactgcagactgatg |
140 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||| |
|
|
| T |
33673954 |
agatcttacagatgatataaatgcagattgatg |
33673986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University