View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5828-13 (Length: 125)
Name: Solexa-NF5828-13
Description: NF5828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5828-13 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 2e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 2 - 125
Target Start/End: Original strand, 13107666 - 13107792
Alignment:
| Q |
2 |
ttgaagcaattttggaatttggatgttattttgcatcccaagnnnnnnnnnnatta---actatatcaatatgtttgcttgcctgtgagtttatttttct |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13107666 |
ttgaagcaattttggaatttggatgttattttgcatcccaagtttttttttttttatcaactatatcaatatgtttgcttgcctgtgagtttatttttct |
13107765 |
T |
|
| Q |
99 |
gcaaataggaagcaatattggctgtag |
125 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
13107766 |
gcaaataggaagcaatattggctgtag |
13107792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University