View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5828-14 (Length: 116)
Name: Solexa-NF5828-14
Description: NF5828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5828-14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 6e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 6e-53
Query Start/End: Original strand, 8 - 116
Target Start/End: Complemental strand, 43589406 - 43589298
Alignment:
| Q |
8 |
atcacatgtgcacgtatacctgtctgtaaatagtaaaaaccatcaaaacaacagacttgttgtctctcttgactatatataatacttaatgtgattaatg |
107 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43589406 |
atcacatgtgcacgtatacttgtctgtaaatagtaaaaaccatcaaaacaacagacttgttgtctctcttgactatatataatacttaatgtgattaatg |
43589307 |
T |
|
| Q |
108 |
acacaagct |
116 |
Q |
| |
|
||||||||| |
|
|
| T |
43589306 |
acacaagct |
43589298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University